pcig3 mcherry rab5 dn (Addgene inc)
Addgene inc is a verified supplier 
92
Structured Review
Addgene inc
pcig3 mcherry rab5 dn
Pcig3 Mcherry Rab5 Dn, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcig3+mcherry+rab5+dn/pCIG3_mCherry_Rab5_DN+(Plasmid+%2375111)/bio_rxiv__2021__10__11__464011-377-31-38
Average 92 stars, based on 1 article reviews
Pcig3 Mcherry Rab5 Dn, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcig3+mcherry+rab5+dn/pCIG3_mCherry_Rab5_DN+(Plasmid+%2375111)/bio_rxiv__2021__10__11__464011-377-31-38
Average 92 stars, based on 1 article reviews
pcig3 mcherry rab5 dn - by Bioz Stars,
2026-10
92/100 stars
Images
Related Articles
Stable Transfection:Article Title: Loss of TBK1 activity leads to TDP-43 proteinopathy through lysosomal dysfunction in human motor neurons Article Snippet: .. Stable cell lines expressing inducible shATG7 and GFP-mCherry-RAB5-DN were made by lentivirus infection. shATG7 hairpin sequence GGAGTCACAGCTCTTCCTTAC was from Dou lab, and was cloned into Tet-pLKO-puro ‘all-in-one’ tetracycline-inducible vector ( ). Expressing:Article Title: Loss of TBK1 activity leads to TDP-43 proteinopathy through lysosomal dysfunction in human motor neurons Article Snippet: .. Stable cell lines expressing inducible shATG7 and GFP-mCherry-RAB5-DN were made by lentivirus infection. shATG7 hairpin sequence GGAGTCACAGCTCTTCCTTAC was from Dou lab, and was cloned into Tet-pLKO-puro ‘all-in-one’ tetracycline-inducible vector ( ). Infection:Article Title: Loss of TBK1 activity leads to TDP-43 proteinopathy through lysosomal dysfunction in human motor neurons Article Snippet: .. Stable cell lines expressing inducible shATG7 and GFP-mCherry-RAB5-DN were made by lentivirus infection. shATG7 hairpin sequence GGAGTCACAGCTCTTCCTTAC was from Dou lab, and was cloned into Tet-pLKO-puro ‘all-in-one’ tetracycline-inducible vector ( ). Sequencing:Article Title: Loss of TBK1 activity leads to TDP-43 proteinopathy through lysosomal dysfunction in human motor neurons Article Snippet: .. Stable cell lines expressing inducible shATG7 and GFP-mCherry-RAB5-DN were made by lentivirus infection. shATG7 hairpin sequence GGAGTCACAGCTCTTCCTTAC was from Dou lab, and was cloned into Tet-pLKO-puro ‘all-in-one’ tetracycline-inducible vector ( ). Clone Assay:Article Title: Loss of TBK1 activity leads to TDP-43 proteinopathy through lysosomal dysfunction in human motor neurons Article Snippet: .. Stable cell lines expressing inducible shATG7 and GFP-mCherry-RAB5-DN were made by lentivirus infection. shATG7 hairpin sequence GGAGTCACAGCTCTTCCTTAC was from Dou lab, and was cloned into Tet-pLKO-puro ‘all-in-one’ tetracycline-inducible vector ( ). Plasmid Preparation:Article Title: Loss of TBK1 activity leads to TDP-43 proteinopathy through lysosomal dysfunction in human motor neurons Article Snippet: .. Stable cell lines expressing inducible shATG7 and GFP-mCherry-RAB5-DN were made by lentivirus infection. shATG7 hairpin sequence GGAGTCACAGCTCTTCCTTAC was from Dou lab, and was cloned into Tet-pLKO-puro ‘all-in-one’ tetracycline-inducible vector ( ). |